Courses
Courses for Kids
Free study material
Offline Centres
More
Store Icon
Store

NCERT Solutions For Class 12 Biology Chapter 5 Molecular Basis Of Inheritance - 2026-27

ffImage
banner

Molecular Basis of Inheritance Class 12 Questions and Answers

Looking for ncert solutions for class 12 biology chapter 5 pdf download? Chapter 5 covers the molecular basis of inheritance, which explains how genetic information is stored and passed on through DNA. This chapter teaches you about DNA structure, RNA types, protein synthesis, and genetic codes. Vedantu's Class 12 Biology NCERT Solutions make these complex topics easy to understand with clear explanations.

toc-symbolTable of Content
toggle-arrow


The solutions include:

  • Simple explanations of DNA replication, transcription, and translation processes
  • Solutions to ncert question answers class 12 biology chapter 5 with diagrams
  • Clear notes on genetic code, mutations, and protein synthesis


These solutions help you understand difficult concepts like DNA structure and protein synthesis in simple terms. Each answer is written in easy language with proper examples and diagrams. Download the ncert solutions class 12 biology chapter 5 pdf for free and prepare well for your exams!

Competitive Exams after 12th Science
tp-imag
bottom-arrow
tp-imag
bottom-arrow
tp-imag
bottom-arrow
tp-imag
bottom-arrow
tp-imag
bottom-arrow
tp-imag
bottom-arrow

Molecular Basis of Inheritance Class 12 Questions and Answers

1: Group the Following As Nitrogenous Bases and Nucleosides:

Adenine, Cytidine, Thymine, Guanosine, Uracil and Cytosine

Ans:

Nucleosides

Nitrogenous Bases

Cytidine

Adenine

Guanosine

Thymine


Uracil


Cytosine


2:  If a Double Stranded DNA has 20% of Cytosine, Calculate the Percent of Adenine in the DNA.

Ans: In the double helix model or in double-stranded  DNA the ratio between the adenine and thymine molecule is the same, whereas the ratio between the guanine and cytosine is the same. 

In 100% of DNA, if the percent of cytosine is 20% then the percent of guanine is also equal to 20%. By adding the percentage of cytosine and guanine total of 40% are present and the remaining 60% of DNA is formed by adenine and thymine.

Thus in DNA, there is 30% of adenine and 30% of thymine.

So, the percent of adenine in DNA is 30%.


3:  If the Sequence of One Strand of DNA is Written as Follows:

5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write Down the Sequence of Complementary Strand in 5' → 3' Direction

Ans: The DNA double strands are complementary strands where one base pair forms pairing with other base pairs like adenine with thymine and cytosine with guanine. The given sequence of one strand is  5'- ATGCATGCATGCATGCATGCATGCATGC - 3'

In 3' to 5' direction the sequence will form like,

3'- TACGTACGTACGTACGTACGTACGTACG - 5'

Therefore,  in 5' to 3' direction the sequence of the complementary strands will  form  like,

5'- GCATGCATGCATGCATGCATGCATGCAT - 3'


4: If the Sequence of the Coding Strand in a Transcription Unit is Written as Follows: 5'-ATGCATGCATGCATGCATGCATGCATGC-3'

Write Down the Sequence of mRNA.

Ans: In the transcription unit the coding strand does not code for anything therefore the sequence remains the same, only the thymine get replaced by uracil.

If the given sequence is   5'- ATGCATGCATGCATGCATGCATGCATGC-3'

Then the  sequence of mRNA form will be 5' - AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3'


5: Which Property of DNA Double Helix led Watson and Crick Hypothese Semi-Conservative Mode of DNA Replication? Explain.

Ans: The following  properties of DNA double helix led Watson and Crick hypothesis semi-conservative model of DNA replication,

  1. The antiparallel and complementary nature of DNA double-strand with respect to the base sequence. Due to this, each strand acts as a template strand for the synthesis of new strands.

  2. Semi conservative nature of DNA due to the presence of one parental strand and one newly synthesised strand. 

  3. The sequence of the base of the template strand forms the sequence of the daughter strand due to the complementary nature of DNA.


6: Depending Upon the Chemical Nature of the Template (DNA or RNA) and the Nature of Nucleic Acids Synthesized from it (DNA or RNA), List the types of Nucleic acid Polymerases.

Ans: There are mainly  four types  of nucleic acid polymerases are present, such as

  • DNA-dependent DNA polymerases- It is the main polymerase enzyme that helps in replicating the parental strands(Template DNA) by which new strands of DNA form.

  • DNA-dependent RNA polymerase- It is the main polymerase enzyme in the transcription process where the RNA gets formed by copying one strand of the DNA.

  • RNA-dependent DNA polymerase

  • RNA-dependent RNA polymerase


7: How Did Hershey and Chase Differentiate Between DNA and Protein in Their Experiment While Proving That DNA Is the Genetic Material?

Ans: Alfred Hershey and Martha Chase in 1952 work with the bacteriophage and E.Coli to find out the genetic material between DNA and protein by the following process.

  1. To find out the genetic material between DNA and protein, they cultured some viruses in radioactive phosphorus and some in radioactive sulfur.

  2. In radioactive phosphorus, the virus consists of radioactive DNA but not protein, whereas in radioactive sulfur the virus consists of radioactive protein but not radioactive DNA.

  3. This radioactive virus and radioactive phages are then inserted into E.Coli which cause the spread of infection.

  4. The viral coat gets remove by agitating the phages in the blender, due to this the virus particle get separated from bacteria in a centrifuge.

  5. The virus-carrying DNA transmitted the infection to bacteria whereas the virus-carrying protein does not. 

Therefore it concluded that between DNA and protein DNA is the genetic material.


 8:Differentiate Between the Following

1)  Repetitive DNA and satellite DNA

      Ans:

            Repetitive DNA

                    Satellite DNA

1) It is a type of DNA sequence that   consists of small repeated segments.

1) It is a type of repetitive DNA sequence that consists of highly repetitive DNA.

2) By density gradient centrifugation they can be separated from bulk DNA and in this form, they appear as light bands.

2) By density centrifugation, they can be separated from bulk DNA and in this, they appear as dark bands and small peaks.

3) The length may vary from small.   A number of base pairs to hundreds and thousands of base pairs.

3) They are shorter in length and up to a hundred base pairs long.



2)  mRNA and tRNA

       Ans:

                      mRNA

                          tRNA

1) In the transcription process, it helps in providing the template and therefore it is also known as messenger RNA.

1) In transcription, it acts as an adaptor that brings the amino acids and reads the genetic code therefore it is also known as transfer RNA.

2) It has a linear shape.

2) It has an inverted L shape and it look like a cloverleaf. 

3) It shows attachment with ribosomes only

3) It shows attachment with both ribosomes and amino acids. From one end it is attached with a ribosome and from another end, it is attached with amino acids.


3)  Template strand and coding strand

              Template strand 

                    Coding strand

1) During the transcription process, template strands work as a template for the synthesis of mRNA.

1) During the transcription process, the coding strand does not code for anything and act as a complementary strand of the template strand. 

2) It has a sequence complementary to the mRNA

2) It has a sequence identical to mRNA except that thymine in DNA is replaced by uracil in mRNA

3) Its direction is  from 3' to 5'

3) Its direction is from 5' to 3'.


9: List Two Essential Roles of the Ribosome During Translation.

Ans: During translation, the two essential roles performed by the ribosomes are as follow:

  • The synthesis of protein takes place by the ribosome because it acts as a cellular factory. It is divided into two subunits in its inactive state, one is a large subunit and one is a small subunit. In large subunits bind amino acids and when the mRNA enters in small subunits and by this the synthesis of protein begins.

  • During translation ribosomes also act as catalysts for peptide bond formation and this catalyst is a ribozyme.


10: In the Medium Where E. coli Was Growing, Lactose Was Added, Which Induced the Lac Operon. Then, Why Does Lac Operon Shut Down Some Time After Addition of Lactose in the Medium?

Ans:

  • In the lac operon, lactose acts as an inducer that regulates switching on and off of the operon. Apart from this lac operon also consists of one regulatory gene and three structural genes which are z,y and a. 

  • The regulatory gene I code for repressor and in structural gene the z code for beta-galactosidase, y for permease and a-gene for transacetylase. The three structural genes metabolised lactose.

  • When lactose was added to the E.Coli medium, it gets transported into the cell by the action of permease and shows binding with the repressor, due to this the RNA polymerase gets bind with the promoter region, hence the synthesis of products of the structural gene get initiated which also led to the metabolization of glucose and galactose. 

  • Due to the metabolism of lactose, the level of lactose gets decreased and the formation of a repressor starts. The binding of the repressor to the operator prevents the transcription of RNA polymerase. This is called negative regulation because of the stoppage of the transcription process.


11: Explain(in one or two lines) the Functions of the Following:

(a)  Promoter

Ans: (1) It initiates the process of transcription.

         (2) It provides the binding site for RNA polymerase.


(b)  tRNA

Ans: (1) It reads the genetic code of messenger RNA.

         (2) During translation it carries a specific ribosome to mRNA to initiate the process.


(c)  Exons

Ans: (1) It is the coding sequence of DNA that transcribes proteins.

(2) In between the long sequence of axons introns are present which disappear in    the mature one.


12: Why is the Human Genome Project called a Megaproject?

Ans: Human Genome Project is called a megaproject because of the following reasons:

  1. The human genome has 3×109 base-pair approximately and if it is required 3 US dollars per base pair then its estimated cost will go approximately to 9 billion US dollars.

  2. If its sequence were stored in a book in the typed form then each page will consist of 1000 letters and each book will consist of approximately 1000 pages which led to the formation of 3300 books from a single human cell.

 For all this, high computational devices are required for data storage, retrieval and analysis. 


13: What is DNA Fingerprinting? Mention its Application.

Ans: The technique which is used to identify and analyse the variation in DNA in every individual is known as DNA fingerprinting.

The various applications of DNA fingerprinting are as follow:

  1. In forensic science, it is used for identifying potential crime suspects.

  2. It is used for finding out paternity and family relationships.

  3. It is used for the identification and protection of commercial crop varieties and livestock.

  4. It is used to find out the evolutionary relationship and linkage between the various organisms.


14: Briefly Describe the Following:

  1. Transcription:

Ans: The process of formation of mRNA from the DNA template is known as transcription. In this process, a single strand of DNA gets copied into mRNA. It starts at the promoter region of the template DNA and stops or terminates at the terminator region of the template. Between these two regions, a transcription unit is present. The process of transcription is catalysed by DNA dependent RNA polymerase.

  • Initiation, elongation and termination are the three main processes of transcription.

  • At the promoter region of the template strand the DNA dependent RNA polymerase and initiation factor-like (σ) bind and the process of transcription gets initiated.

  • Due to enzymes the DNA double helix unwinds and then one of the strands, called sense strand, starts mRNA synthesis and this strand is called the template strand. The process of transcription remains continuous until the terminator region.

  • As the transcription enzymes reach the terminator region, the enzyme and the newly synthesised mRNA are released.  The termination takes place by the termination factor(ρ).


  1. Polymorphism

Ans: Polymorphism is a form of genetic variation in which distinct nucleotide sequences can exist at a particular site in a DNA molecule in a population. This heritable mutation is observed at a high frequency in a population. It arises due to mutation either in a somatic cell or in germ cells. The germ cell mutation can be transmitted from parents to their offspring. This results in the accumulation of various mutations in a population, leading to variation and polymorphism in the population. This plays a very important role in the process of evolution and speciation. Polymorphism in DNA sequences is the basis for gene mapping and DNA fingerprinting.


  1. Translation

Ans: -Translation is the process of polymerizing amino acids to form a polypeptide chain. The triplet sequence of base pairs in mRNA defines the order and sequence of amino acids in a polypeptide chain.

The process of translation involves three steps :

Initiation

Elongation

Termination

During the initiation of the translation, tRNA gets charged when the amino acid binds to it using ATP. The start (initiation) codon (AUG) present on mRNA is recognized only by the charged tRNA. The ribosome acts as an actual site for the process of translation and contains two separate sites in a large subunit for the attachment of subsequent amino acids. The small subunit of ribosome binds to mRNA at the initiation codon (AUG) followed by the large subunit. Then, it

initiates the process of translation. During the elongation process, the ribosome moves one codon downstream along with mRNA so as to leave the space for binding of another charged tRNA. The amino acid brought by tRNA gets linked with the previous amino acid through a peptide bond and this process continues resulting in the formation of a polypeptide chain. When the ribosome reaches one or more STOP codons (VAA, UAG, and UGA), the process of translation gets terminated. The polypeptide chain is released and the ribosomes get detached from mRNA.


  1. Bioinformatics

Ans: Bioinformatics is the application of computational and statistical techniques to the field of molecular biology. It solves the practical problems arising from the management and analysis of biological data. The field of bioinformatics developed after the completion of the human genome project (HGP). This is because an enormous amount of data has been generated during the process of HGP that has to be managed and stored for easy access and interpretation for future use by various scientists. Hence, bioinformatics involves the creation of biological databases that store the vast information of biology.

It develops certain tools for easy and efficient access to information and its utilization. Bioinformatics has developed new algorithms and statistical methods to find out the relationship between the data, predict protein structure and their functions, and cluster the protein sequences into their related families.


Chapter 5 Class 12 Molecular Basis of Inheritance: Quick Overview of Topics Covered 

S. No

Chapter 5: Molecular Basis of Inheritance 

Topics

Subtopics

2

The DNA

Structure of Polynucleotide chain, Packaging of DNA Helix,

3

Central Dogma

-

4

The Search for Genetic Material

Genetic Material is DNA, Properties of Genetic Material

5

RNA World

-

6

Replication

The Machinery of the enzymes,

7

Transcription

Transcription Unit, Transcription unit and the gene,

8

Genetic Code

Mutations and genetic code, tRNA

9

Translation

-

10

Regulation of Gene Expression

The Lac Operon,

11

Human Genome Project

Salient Features of Human Genome, Applications, and Future Challenges

12

DNA Fingerprinting

-


Benefits of Chapter 5 Molecular Basis of Inheritance Class 12 NCERT Solutions

  • The NCERT solutions are made to ensure students clearly understand the use of appropriate terminology. 

  • Students should go through this Molecular Basis of Inheritance questions and answers for a thorough revision of all the topics covered in this chapter.

  • Since the Class 12 Biology chapter 5 PDF is prepared about the latest CBSE guidelines, students can follow and incorporate the format of these solutions while writing their answers. 

  • By referring to these NCERT Solutions students will get a clear idea of all the important topics like constitute particles and biological components like proteins, DNA, and RNA. 

  • The Molecular Basis of Inheritance NCERT PDF is of utmost importance for your exam preparation topics like Codons and three-nucleotide sequences on mRNA, which specify amino acids during protein synthesis, are covered.

  • Class 12 Biology Chapter 5 PDF is free to download.

  • Easy explanations are provided for Chapter 5, Molecular Basis of Inheritance Class 12 NCERT Solutions, given in the exercises. 

  • Diagrams with proper labelling are provided for the answers.


Important Study Materials for Chapter 5 - Molecular Basis of Inheritance 


Conclusion

Class 12 Biology Chapter 5 Molecular Basis of Inheritance NCERT Solutions provides students with a comprehensive and in-depth understanding of genetic inheritance's intricate processes. With a focus on DNA replication, transcription, translation, and gene regulation, the Molecular Basis of Inheritance Class 12 PDF elucidates the molecular mechanisms underlying heredity. Overall, the Molecular Basis of Inheritance Class 12 NCERT Solutions empowers students to grasp the fundamental principles of molecular genetics and excel in their academic pursuits.


NCERT Solutions for Class 12 Biology | Other Chapter-wise Links

Below are the other chapter-wise links for NCERT Solutions for Class 12 Biology.




Other Related Links for Class 12 Biology

FAQs on NCERT Solutions For Class 12 Biology Chapter 5 Molecular Basis Of Inheritance - 2026-27

1. How do NCERT Solutions for Class 12 Biology Chapter 5 approach the explanation of DNA replication for CBSE exams?

The solutions provide a step-wise breakdown of DNA replication, describing the semi-conservative model where each parental DNA strand serves as a template for the synthesis of a new strand. Key steps include unwinding of the double helix, the role of enzymes like DNA polymerase, and the importance of complementary base pairing (A pairs with T, G pairs with C), following the exact framework recommended in the CBSE 2026–27 syllabus.

2. What method is suggested in NCERT Solutions for solving genetic code and gene expression questions in Chapter 5?

The solutions recommend using the codon table and following a step-by-step approach to decode mRNA sequences and predict the resulting amino acid chain. Students are encouraged to explicitly show how each codon translates to an amino acid and to explain the function of start (AUG) and stop (UAA, UGA, UAG) codons, matching CBSE's exam answer expectations.

3. How do NCERT Solutions clarify the difference between template and coding strands during transcription in Class 12 Biology?

The solutions highlight that the template strand runs in the 3'→5' direction and is actually used to synthesize mRNA, while the coding strand has the same sequence as the mRNA (except thymine is replaced by uracil). This distinction is crucial for correctly answering both concept and application questions in the board exams.

4. In what way do step-wise NCERT Solutions reduce conceptual errors in the Molecular Basis of Inheritance chapter?

Step-wise solutions break complex processes like replication, transcription, and translation into manageable, logical stages. They also provide clearly labelled diagrams and use CBSE-mandated terminology, which minimizes confusion and ensures clarity on exam papers.

5. What features make NCERT Solutions for Chapter 5 particularly useful for competitive exams like NEET?

The structured, CBSE-aligned answers build strong conceptual foundations in genetics, molecular biology, and central dogma, which are frequently tested topics in NEET. The solutions also emphasize common traps and stepwise logic, which is beneficial for both board and entrance exam preparation.

6. Why is it important to use only CBSE-pattern solutions for Chapter 5: Molecular Basis of Inheritance?

CBSE-pattern solutions ensure that all answers include the correct scientific steps, terminology, and diagrammatic representation as per the latest official marking scheme. This alignment increases scoring accuracy and prevents marks being lost due to format errors or omission of scientific reasoning steps.

7. How do the solutions explain the significance of the Hershey-Chase experiment in proving DNA as genetic material?

The NCERT Solutions provide a detailed summary of the Hershey-Chase experiment, emphasizing how radioactive DNA (labelled with phosphorus) and radioactive protein (labelled with sulfur) were used to show that only DNA enters bacteria to direct viral reproduction. This experiment is described stepwise, supporting students in writing exam-ready answers.

8. What common student misconceptions about DNA packaging and the Human Genome Project are corrected by the NCERT Solutions?

The solutions clarify that DNA packaging involves histones and supercoiling, leading to efficient storage of genetic material in small cellular spaces. Regarding the Human Genome Project, explanations focus on its scale—sequencing approximately 3 billion base pairs—and the significance of international collaboration and high computational needs, correcting the notion of it being a simple sequencing task.

9. According to NCERT Solutions for Class 12 Biology, how does the Lac Operon function in gene regulation?

The Lac Operon acts as a genetic switch for lactose metabolism in bacteria. The regulatory gene produces a repressor that binds to the operator, preventing transcription. Lactose acts as an inducer, deactivating the repressor and allowing structural genes to be transcribed. This mechanism is presented in clear steps with functional roles of each component as per the CBSE pattern.

10. How are differences between repetitive DNA and satellite DNA illustrated in the chapter's NCERT Solutions?

  • Repetitive DNA: Small segments repeated many times, usually forming lighter bands during centrifugation, contributing to genetic variability.
  • Satellite DNA: Highly repetitive, forms distinct dark bands (satellites) on density gradient centrifugation, with key roles in chromosome structure and DNA fingerprinting.
These differences help students tackle 'difference between' questions as per exam standards.

11. What is the central dogma of molecular biology as presented in the NCERT Solutions for Class 12 Biology Chapter 5?

The central dogma describes the one-way flow of genetic information: DNA → RNA → Protein. It illustrates how information is first transcribed from DNA to RNA, then translated from RNA to a functional protein, underpinning all genetic expression and inheritance.

12. What techniques in DNA fingerprinting are highlighted in the NCERT Solutions, and what are their major applications?

Techniques such as restriction enzyme digestion and gel electrophoresis are highlighted for the identification of unique DNA patterns. Major applications include forensic investigations, paternity testing, biodiversity studies, and the identification of genetic relationships among species.

13. How do the solutions demonstrate the difference in structure and function between mRNA and tRNA?

  • mRNA (messenger RNA): Linear structure, carries genetic information from DNA to the ribosome for protein synthesis.
  • tRNA (transfer RNA): Cloverleaf/inverted L-shaped, brings specific amino acids to the ribosome and decodes the mRNA sequence during translation.
Understanding this difference is essential for answering CBSE 'difference between' questions in molecular biology.

14. In what ways do NCERT Solutions for this chapter support improved performance in board and competitive exams?

They provide precise, stepwise answers for all exercise questions, clarify complex processes, and use terminology and answer structures that closely match CBSE 2026–27 marking guidelines. This targeted approach leads to higher answer accuracy and increased confidence.

15. What are the essential steps in the process of translation as outlined in the NCERT Solutions for Molecular Basis of Inheritance?

The process of translation includes:

  • Initiation: Ribosome assembly at the start codon (AUG) on mRNA and arrival of the first tRNA.
  • Elongation: Sequential addition of amino acids via codon-anticodon matching, forming a growing polypeptide chain.
  • Termination: Recognition of stop codons (UAA, UGA, UAG) leading to release of the complete polypeptide and disassembly of the translation complex.
Each step is explained according to CBSE guidelines for exam readiness.