Courses
Courses for Kids
Free study material
Offline Centres
More
Store Icon
Store
seo-qna
banner

If the sequence of one strand of DNA is written as follows:
5’$-$ ATGCATGCATGCATGCATGCATGCATGC $-$ 3’
Write down the sequence of the complementary strand in 5’$\rightarrow$3’ direction.

Answer
VerifiedVerified
610.2k+ views
Hint: One of four bases is attached to each sugar — adenine (A), cytosine ( C), guanine (G), or thymine (T). Hydrogen bonds between the bases keep the two strands together, with adenine forming a base pair with thymine and cytosine forming a base pair with guanine.

Complete step by step answer:
ACGT is an acronym for the DNA molecule's four base types: adenine (A), cytosine (C), guanine (G), and thymine (T). Two strands woven around each other consist of a DNA molecule, with each strand kept together by bonds between the bases. Adenine is combined with thymine, and guanine is combined with cytosine.
The base pairing (or nucleotide pairing) laws are:
- A with T: adenine purine (A) is often combined with thymine pyrimidine (T)
- C with G: cytosine pyrimidine (C) is often combined with guanine purine (G)
Pairs with T and C with G, according to complementary base pairing. The complementary strand for the given sequence will be 3' $-$ TACGTACGTACGTACGTACGTACGTACG $-$ 5’. The sequence of the complementary strand in the direction of 5' to 3' is therefore, 5' $-$ GCATGCATGCATGCATGCATGCATGCATGCAT $-$ 3'.

Additional information: In DNA, complementary base pairing is important because it allows the base pairs to be arranged in the most energetically favorable way; in forming the helical structure of DNA, it is necessary. In replication, it is also important as it enables semiconservative replication.

Note: Chargaff determined that the amount of one base, purine, in DNA is often roughly equal to the amount of a specific second base, pyrimidine. In the DNA double helix, the rule forms the basis of base pairs: A always pairs with T and G always pairs with C.